Adaptation

Heat and its effects on Homeostasis

Heat as many effects on us some are heat exhaustion which causes dizziness, headaches, and fainting; heatstroke causing body temperature of over 103 and dry skin; sunstroke and organ damage.  Some of this can be treated by rest and water, but some are very serious and need the assistance of a doctor.

How we adapt to Heat

A short term adaptation we take against heat is sweating. When are body begins to heat up are body begins to sweat in order to help our bodies to cool down.

Developmental adaptation: Someone who is small/thinner as a better time dealing with heat. Someone who is big as more cells which cause heat. So someone who is small/thin would have less cell therefore don’t have that much body heat.

Facultative adaptation: Our body normal core temperature is 37-38C and when our bodies begins to heat up around 39-49C our brain tell or muscles o slow down which causes fatigue. Above 41C the body begins to shut down and this is a when it becomes very dangers.

Some Cultural adaptation that we make is when it’s hot we move to cooler places (travel), we change the way we dress. And we come up with different invention to make it cooler where we are. Some examples would be shorter clothes, wearing lighter/thinner fabrics, swimming pools, air conditioner, fans.

The benefit to looking and studying human variation in this way is that we are able to see the way that we react to different environments. Through seeing how we react to environments we are allowed to find way to adapt and survive. We are able to come up with homes that can survive different environments and help us to survive different types of weather. As well us we are able to come up with things to help survive outside the comfort of our homes like products and clothing.

Different races live in different environments and in those in environments they do not have access to the same resources as those in other places. So then you have to look at those details when going in. As well you will have to look at the different skin 7tones, the body shapes and sizes. But with some of the other categories like short-term and facultative adaptation those are qualities we are born with so race wouldn’t help with studying those.

Language Blog

Shh, No speaking

When starting the conversation it was pretty easy, but as the conversation went on it me came more and more difficult to tell what the person is saying. However towards the end we started to make the symbols a little simpler for the other person to understand. At first the impression were very dramatic but as the conversation went on the impression were simplified and slowed down for the other to understand it more. If my partner and I were from different culture I believe the culture that speaks more through body language and gesture would be the one to be able to communicate complex ideas because they are relying on body language and they have to be more dramatic then the person who is speaking.  How would the person that speaks look at the person that speaks through body language? There can be both positive and negative feedback; they can think that to something terribly wrong with the person or they can be fascinated and willing to learn and get an understanding.  In our culture we have people that do not speak with a spoken language because they were born without the ability to hear or because they were born with a disability and they aren’t able to speak. Some are scared and don’t know how to act or respond, so they negatively (bullying, harass) there are some who react positively wanting to learn and understand.



Speaking  Robot Like

No I was not able to last the whole 15 minutes; what made the experiment difficult was that they why we had to talk made the conversation very boring, also you found yourself having to constantly stop yourself from using facial expressions and hand gestures. My partners found it very difficult as well to talk long and with the limitations given. They were trying to fight back making an expression; as well they found it funny to have to speak this way and stay speaking this way for the whole time. By doing this I found that we rely so much on signs when we speak that it is very hard to speak and express what we want without them. No-speech language techniques play an important role for those who need to get their points across or for those who don’t have the ability to speak at all. Yes there are people who have a hard time reading body language but those who can read have the ability to understand what the person is saying or feel even if the person isn’t saying anything or are having a hard time expressing what they want. No I cannot think of a situation where it might be good not to be able to read body language at this time.

Piltdown

Piltman Story

In the early years of the 1900s a man was digging at Barkharm Manor near the village of Piltdown. While digging this person found a piece of skull. He then passed the piece on to Charles Dawson who was an amateur archaeologist at the time. Dawson believed that the skull looked primitive. Because of Darwin theory of evolution they believed that the completed skull was a mixture of part ape part human. Dawson wrote to London’s natural history museum and Woodward believed that this would be a great discovery for Britain and set off to explore with Dawson. They found the remains of prehistoric animals and tools; the jawbone was ape and the teeth humanlike, this similar to the one Dawson had. Dawson and Woodward unveiled piltman to the world. The British were extremely happy finally they had something from Britain. Many scientists believed in the Piltman and backed it up. But little did they know that it was a fake. Later on down the road the Piltman was studied and they could see that the teeth had scratch marks, meaning that the teeth were filed down and the jawbone carved and stained, as well as pieces missing so that you could not see that the pieces were not meant to be together. This lead to people believe that if this could happened does that mean everything else we learned from  science is untrue and fake as well. This brought a lot of negativity (unneeded) to science.

Faults/Negativity

Some human faults that come into place is trust, as well as wanting to belong. Trust being the biggest; someone thought long and hard about this and took their time thinking it through and executing it; deceiving everyone for years and years. And the sense of wanting to belong; like Britain wanted to be a part of something, they quickly sent someone out to help explore. This negativity impacted science because it cause many to question science more not just future science but pass as well.

Positive

Testing the authentication of the skull proved positive for science. During a chemical test of the skull it proved that the skull was actually much young than expected. The skull was also put through a test to test it nitrogen content.  The finding the skull was bogus.

Human Factor and Science

Would it be possible to remove human factor from science to remove any chance of error like discussed in the piltman case. The only way to remove human factors would be to remove human completely but, without human there wouldn’t be science. The only way to help this from happening again would be test, test, and retest. Retesting and the same outcome continue will prove it right; not just retesting but retesting with a completely new team.

Outlook

You cannot always take the word of others; the information needs to be tested by multiple. Like when you are completing a research paper you can’t trust Wikipedia because anyone can add information and it isn’t test to be proven right or wrong. But if you go by another they have multiple resources to prove what they are stating to you it correct.

Comparative Primate

Environment/Overview

There are about 5 species of lemurs but because of changes has caused some to go extinct. Lemurs are native to the island of Madagascar and the neighboring island Comoro. Madagascar is divided into two parts, each with their own distinct climate. Focusing on the ring-tailed lemur’s native to the south of Madagascar in the dry forest and bush. The ring-tailed lemur has brown and gray fur a tail with black and white rings. Even though the lemurs are capable of climbing they spend a great deal of their time on the ground. When on land they use ways to communicate and stay together by leaving a scent and holding their tails up in the air. The spider monkey lives in tropical rain forest of Central and South America, spending most of in the air and hanging from braches. They have long flimsy arms and a tails that allows them move from branch to branch, tree to tree. There are about 5 different species of baboons living in Africa and Arabia. These are some of the world’s largest monkeys. Because they do not have a gripping tail they spend most of their time on ground but, do climb trees to eat, sleep, and look out for trouble. The Gibbon live in South Asia, because of their strong hook-shaped hands they are able to grip branches. They have oversized arms and long powerful legs for propelling; and shoulder joints that allow for greater range of motion, so they a very rarely on the ground.Chimpanzees walk on all fours some time up straight live in African rain forests, woodlands, and grasslands.

Week3

Homologous

a. A dolphins flipper compared to the human arm.

b. A human and a dolphin have arms and flippers the dolphin’s flipper compared to a human are is that the dolphins as similar bones to that of a human arm. Humans and dolphin both have a humerus, ulna, radius but the dolphins is short and fat compared to a humans.

  

c. The dolphin and human are mammals. I can know that these ancestor possessed this trait because mammal have traits that classify them as mammals (all of them have) some being a warm-blooded vertebrate(characterized by a bony or cartilaginous skeleton and a well-developed brain) have hair or fur, nurse their young, and the birth of live young.

Analogous

a.  A human arm and a horse leg.

b. A humans arm and a horse legs serves the same purpose but the structure of the two are different if looked internally (x-ray) you will better see the difference. 

The phalanges, 2nd Metacarpal, 4th Metacarpal looks completely different; the phalanges on a human are skinny and there are multiple as the horse their are big and chunky.

c. Yes the it is possible that the common ancestor of these species could have possessed these traits but not quite the same model. Like a cell phone evolves, as time goes on something is done that makes the phone better than the last; these traits evolve like that. Genetic traits are genotypic similarities passed on from parents to offspring during the chromosomal replication process. Some examples being hair or eye color, and likelihood of getting a disease.






   



                                                                                                                                           

DNA Decoding

TACTAAGGCTATACAAGTACGCCCATC

Have fun decoding

Darwin's Influences

Influence/Contribution

A person I feel had a substantial influence on Charles Darwin evolution theory is Charles Lyell a geologist and paleontologist. Charles Lyell befriended Charles Darwin and influenced the way Darwin thought and approach his own theory. In fact by reading Lyell’s Principles of Geology; it allowed Darwin to see evolution as a slow process over a large period of time. Lyell talked greatly about natural law and challenges other geologist that based their findings on a great flood; he believed that it was easy to believe that everything we have today is what it is because it has always been. Lyell helped and influenced Darwin theory as well as came to Darwin’s assistance when he became overwhelmed and helped him to publish.

http://www.macroevolution.net/charles-lyell.html#.U__NLfldW1U

Charles Lyell Work

Charles saw that when others talked about the catastrophist theory it was used to accommodate the belief of the great flood into science, instead he looked further into it and focused not on the drastic changes of earth; he believed that the majority of earth’s changes were because of events such as sediment deposition and erosion. Some points of Lyell are all organisms have the potential of reproducing, resources, environmental changes, natural selection and, artificial selection. Lyell believed that the way we survive and live on is what we have always done. If you reproduce, pass on the traits needed to survive and, learn how to adapt to new environment you are evolving. This the base to Darwin’s theory.

Development and Hardships

What would happen if Darwin didn’t have the influence of individuals? I feel that if the influences weren’t given to Darwin that he would have still been able to develop his theory it just would have taken longer; my perspective on life is that if you are meant to do something then it going to happen regards of some of the actions that have taken place.

The church was not excepting of Darwin theory at all when he published his book he receives a lot of backlash, this lead to sales being very low and the unacceptance of the book but eventually he gain support from others.